Estudo com a raça Sindi destacado em publicação científica australiana


O grupo de pesquisa em Genética e Melhoramento Animal da Escola de Medicina Veterinária e Zootecnia da Universidade Federal da Bahia (EMVZ-UFBA) realiza pesquisas com várias espécies de animais domésticos, entre elas raças bovinas de origem zebuína.

Um projeto coordenado pelo professor Dr. Gregório Camargo estudou a viabilidade de produção de leite A2 com bovinos da raça Sindi. O projeto contou com a colaboração de associados da ABCSindi, principalmente do Núcleo Nordeste de Criadores de Sindi. A pesquisa resultou no Trabalho de Conclusão de Curso do, atualmente mestrando, Gustavo Schettini, sendo a equipe de trabalho composta por outros docentes e técnicos da unidade de ensino.
O leite A2 tem como características ter sua digestão facilitada pela ausência da beta-caseína do tipo A1. A inflamação causada pela beta-caseína A1 em algumas pessoas lembra os sintomas da intolerância a lactose, mas suas causas são distintas. A produção de leite A2 pode ser feita a partir da ordenha de vacas cujo genótipo para a beta-caseína seja A2A2. Os resultados da pesquisa indicaram que 90% das vacas Sindi são A2A2, indicando um potencial genético enorme da raça para produção de leite A2. Seleção por marcadores moleculares podem ser feita com facilidade.
Como forma de validar cientificamente os resultados encontrados, publicou-se o artigo “Genetic potential of Sindhi cattle for A2 milk production” no periódico científico internacional Animal Production Science. O artigo pode ser encontrado na íntegra pelo acesso ao link: https://www.publish.csiro.au/AN/AN18677
“Atividades como essa, conjuntas da universidade com produtores e associações, são essenciais para geração de conhecimento e informação de qualidade, bem como de fomento da pesquisa no Brasil”, diz o professor Gregório.

Abaixo reproduzimos na íntegra o estudo e alertamos para que a reprodução de trechos ou de toda a redação é necessário que seja citada a fonte, como segue abaixo.


Potencial genético da raça Sindi para produção de leite A2.

Fonte: Animal Production Sciense


Gustavo Pimenta Schettini1, Sabrina Mota Lambert1, Bárbara Maria Paraná da Silva Souza1, Raphael Bermal Costa1, Gregório Miguel Ferreira de Camargo1
1Escola de Medicina Veterinária e Zootecnia, Universidade Federal da Bahia (UFBA)

Resumo
O consumo de leite de vaca é um hábito presente em inúmeros países. No entanto, pode estar associado a distúrbios e desordens gastrintestinais em humanos. O perfil genético da ?-caseína é um dos fatores que pode causar essas desordens, sendo a variante A1 um dos agentes causais. O alelo A1 é oriundo de um polimorfismo na forma de SNP C/A que leva a uma alteração no aminoácido de posição 67 (prolina?histidina). A modificação é responsável por criar um sítio de digestão enzimática, em cuja lise há a formação peptídeos bioativos capazes de desencadear alterações intestinais, e que, por sua vez, não ocorre no alelo A2. O leite A2 é obtido a partir de vacas cujo genótipo para a ?-caseína é A2A2 e que, portanto, não possuam ?-caseína A1 em seu leite. A identificação e seleção de raças que possuam potencial genético para a produção de leite A2 é importante para a saúde pública e produção animal. A raça Sindi (Bos taurus indicus) possui características como adaptação ao clima quente, resistência a parasitas e aproveitamento de forragens de baixa qualidade, importantes para criação nos trópicos. Frente a essas informações, o presente trabalho teve como objetivo genotipar o SNP em questão do gene da beta-caseína em bovinos da raça Sindi e verificar a potencialidade da raça para produção de leite A2. Foram utilizados 348 bovinos da raça Sindi. O DNA foi extraído de folículos pilosos e submetidos à reação em cadeia da polimerase (PCR) e sequenciamento para genotipagem. Foram obtidas frequências alélicas de 0,94 para A2 e 0,06 para o A1 e genotípicas de 0,90 (A2A2); 0,09 (A1A2) e 0,01 (A1A1). A frequência do genótipo A2A2 em Sindi mostra-se próximas ou superiores às encontras em raças zebus e superiores às encontradas em raças taurinas especializadas. Essa elevada frequência do genótipo A2A2 indica potencial genético para a produção de leite A2 e fácil seleção assistida, caso seja esse o intuito. Esse informação valoriza a raça e possibilita agregar valor ao produto dela originado em favor do aumento de renda do produtor via seleção assistida por marcadores moleculares.

INTRODUÇÃO
O consumo de leite e produtos lácteos é hábito das sociedades ocidentais. Todavia, há indivíduos que apresentam dificuldade na digestão do leite bovino. Um dos causadores de desordens e intempéries gastrintestinais é a proteína ?-caseína. Tal caseína é codificada pelo gene CSN2 e possui 13 variantes alélicas com destaque para as variantes A1 e A2, as mais frequentes em bovinos (Rijnkels, 2002; Farrel et al., 2004).
Um polimorfismo do tipo SNP C/A localizado na posição 8101 do gene CSN2, no éxon 7, que modifica a trinca de nucleotídeos que forma o aminoácido na posição 67, trocando uma prolina (alelo A2 – nucleotídeo com C) por uma histidina (alelo A1 – nucleotídeo A). A presença da histidina resulta na criação de um sítio para clivagem por enzimas digestivas, inexistente na beta-caseína do tipo A2 (Jinsmaa e Yoshikawa, 1999). A clivagem da beta-caseína A1 gera a formação do peptídeo bioativo ?-casomorfina 7 (BCM-7) responsável por desencadear sintomas gastrointestinais indesejáveis, e por vezes muito similares aos observados em quadros de intolerância a lactose. Os sintomas podem variar desde atraso no trânsito intestinal a inflamação local e consistência das fezes (Barnett et al., 2014; Haq et al., 2014; Ho et al., 2014; Jianqin et al., 2016; Bruno et al 2017).
Com o propósito de solucionar essa questão, surge o leite A2. Esse produto é obtido a partir da ordenha de vacas cujo genótipo para a beta-caseína é A2A2 e que portanto não possuam beta-caseína A1 em seu leite. Para se obter animais com genótipo A2A2, faz-se seleção usando marcadores moleculares. O manejo fica a critério do produtor a depender do seu objetivo de produção (de Camargo 2018).
A frequência genotípica para o gene da beta-caseína varia muito entre taurinos e zebuínos, sendo que as raças zebuínas apresentam, de maneira geral, frequências muito mais altas do genótipo A2A2 do que as taurinas (Kami?ski, Ru?? e Cie?li?ska, 2006; Mishra et al 2009; Rahimi et al., 2015; Dai et al., 2016; Massella et al 2017, Rangel et al., 2017). Estudos também indicam que o alelo A2 está associado a maior produção de leite e proteína (Olesnki et al 2012).
A busca por raças alternativas que possuam genótipos A2A2 é de extrema importância à saúde pública e à produção animal. A raça Sindi (Bos taurus indicus), apresenta características de importância à produção leiteira nas regiões tropicais, tal como adaptação ao clima quente, resistência a parasitas e aproveitamento de forragens de baixa qualidade. Possui ainda pequeno porte e menor exigência nutricional sendo uma opção para regiões semi-áridas onde há dificuldade de produção de forragens de qualidade durante o ano todo (ABCSindi; Núcleo Nordeste dos Criadores de Sindi; ACGZ). O Sindi possui ainda avaliação genética de touros para características leiteiras (ABCZ), mostrando a aptidão e interesse da raça para esse tipo de produção.
Tais características motivaram a realização de genotipagem do SNP em questão do gene da beta-caseína em bovinos da raça Sindi a fim de verificar a potencialidade da raça para produção de leite A2.

MATERIAL E MÉTODOS
Animais e extração de DNA
Um total de 348 bovinos da raça Sindi (fêmeas e machos) foram utilizados no presente estudo. Foram coletados amostras de pelos de 199 animais de seis fazendas parceiras pertencentes ao Núcleo Nordeste de Criadores de Sindi. Foram cedidos os genótipos de 149 animais por dois proprietários que realizaram o teste comercial para o SNP (realizado pela empresa Gene Genealógica LinkGen).
As atividades laboratoriais foram realizadas no Laboratório de Biologia Celular e Molecular da Universidade Federal da Bahia (LBCM-UFBA). A extração realizada a partir de 40 folículos pilosos por animal através do kit comercial MACHEREY-NAGEL NucleoSpin® Tissue (Düren, Germany).

Amplificação parcial do gene da ?-caseína
Para a amplificação do fragmento do gene da ?-caseína por PCR, foram desenhados e utilizados um par de primers foward: 5’ – TGACCCCAATTTCTTAACCAAACCAA – 3’ e reverse 5’ – CTGGCTTTCAGTAAAGGGCTCAACTG – 3’ capazes de amplificar parcialmente o íntron 6 e o éxon 7 onde se encontra o SNP usando o software online gratuito Primer 3. O fragmento amplificado tem tamanho de 389pb.
A reação de PCR fora performada, em um volume final de 25µl, utilizando Tampão (1X); 2mM de MgCl2; 0,4mM de dNTPs; 2,5U de TaqDNA Polymerase (Invitrogen®, Calsbad, CA); 0,5 µM de cada primer; no mínimo de 30ng DNA.
As amplificações foram realizadas em termociclador Applied Biosystems, modelo 2720 (Thermal Cycler), sendo estabelecidas as seguintes condições: desnaturação inicial a 95°C por 5 minutos, seguido por 35 ciclos de 95°C por 1 minuto, 1 minuto a 63°C e a 72°C, e uma extensão final por 5 minutos com temperatura de 72°C. Produtos de PCR foram avaliados por eletroforese em gel de agarose 1,5% e então purificados utilizando-se polietilenoglicol (PEG 8000). Após a limpeza, sua concentração e pureza foram avaliados em espectofotômetro do tipo NanoDropTM (Thermo Fisher Scientific, Massachusetts, USA).

Sequenciamento
Os produtos de PCR foram enviados submetidos à sequenciamento unidirecional (Applied Biosystems™ 3500xL Genetic Analyzers). Com posse da sequência de nucleotídeos, utilizou-se o software MEGA7 para análise dos eletroferogramas e identificação do genótipo dos animais para o referido SNP. A sequência de DNA foi submetida ao NCBI sob numeração: MH800322.
As frequências alélicas e genotípicas foram calculadas por contagem utilizando Microsoft Excel bem como a aderência ao equilíbrio de Hardy-Weinberg pelo teste de qui-quadrado.

RESULTADOS E DISCUSSÃO
A análise das frequências de bovinos da raça Sindi para o gene da beta-caseina revelou uma alta frequência do genótipo A2A2 (0,90) e do alelo A2 (0,94) (Tabela 1). Isso aponta para uma potencialidade genética da raça para a produção de leite deste tipo.
Caso seja do interesse do produtor realizar uma seleção assistida por marcadores moleculares, ela pode ser realizada com facilidade e sem grande detrimento genético do rebanho, pois cerca de 10% do rebanho precisaria ser descartado, não acarretando perda de variabilidade genética substancial.

Tabela 1. Frequência genotípica e alélica para a ?-caseína em bovinos da raça Sindi.
FREQUÊNCIA GENOTÍPICA FREQUÊNCIA ALÉLICA
A2A2 A1A2 A1A1 A2 A1
0,90 0,09 0,01 0,94 0,06

Os dados observados não se encontram em equilíbrio de Hardy-Weinberg Ao se comparar as frequências genotípicas observadas e esperadas, observa-se um aumento do número de dos homozigotos e diminuição dos heterozigotos nas frequências observadas (dados não apresentados). Esse evento vai de encontro à situação menor variabilidade genética relatada para a população Sindi no Brasil (Santana Jr et al 2016).
Outras raças zebuínas (Gir, Guzerá e outras raças indianas) apresentam altas frequências para o genótipo A2A2 (acima de 78%) (Mishra et al 2009; Rangel et al 2017); todavia para raças taurinas as frequências genotípicas do A2A2 são menores (variando de 7,8% a 51,9%, calculados a partir da frequência alélica do A2) considerando várias raças (Jersey, Holandês, Simmnental, Ayshire) (Kami?ski, Ru?? e Cie?li?ska, 2006; Olenski et al 2010; Olenski et al 2012; Dai et al 2016; Massela et al 2017).
Claramente o processo de subespeciação em bovinos levou a uma diferença na frequência alélica entre taurinos e zebuínos, sem necessariamente sabermos o motivo que acarretou o evento. Todavia, torna-se claro que as raças zebuínas (Bos taurus indicus) apresentam condições mais favoráveis de seleção para produção de leite A2.
A pecuária é uma das atividades mais importantes na região semiárida, uma vez que a agricultura não é viável devido as condições edafoclimáticas deste ambiente. A raça Sindi, objeto de estudo, além de adaptada ao clima tropical e de possuir resistência parasitária, apresenta condições de criação em clima semiárido devido ao pequeno porte e baixa exigência nutricional. O uso da raça para produção de leite A2 pode gerar renda extra para produtores nela envolvidos, além dos benefícios advindos para a saúde humana.

CONCLUSÃO
Conclui-se que a raça Sindi apresenta potencial genético para a produção de leite A2, pois a alta frequência do alelo facilita a seleção assistida por marcadores. Estudos futuros de associação com características de produção devem ser feitos a fim de melhor entender o efeito desse polimorfismo na raça. Todavia, como o SNP apresenta aplicabilidade prática, os resultados tornam-se interessantes, aplicáveis e passíveis de divulgação e propaganda com a devida orientação técnica.

Agradecimentos
Os autores agradecem ao Núcleo Nordeste de Criadores de Sindi pelo contato com os associados e organização das coletas de material biológico. Os autores agradecem também aos produtores Waldevan Alves de Oliveira e Eduardo Henrique de Oliveira da Fazenda Asa Branca, Gilberto Browne de Paula da Fazenda Sindi Rajasthan e Ronaldo Andrade Bichuette da Fazenda Bom Jesus da Lapa que nos cederam os genótipos a compor o trabalho.
Ressalta-se, também, que os resultados científicos integram um projeto de extensão, pois os genótipos foram divulgados aos produtores juntamente com orientação técnica para seleção, caso fosse o interesse da propriedade.

Referências


ABCSindi – Associação Brasileira dos Criadores de Sindi. Disponível em: < http://www.sindi.org.br/> Acesso 02 de julho de 2018.
ACGZ – Associação dos Criadores Gauchos de Zebu. Dispnível em: < www.acgz.com.br> Acesso 02 de julho de 2018.
Barnett, M.P.G., Mcnabb, W.C., Roy, N.C., Woodford, K.B., Clarke, A.J., 2014. Dietary A1 ?-casein affects gastrointestinal transit time, dipeptidyl peptidase-4 activity, and inflammatory status relative to A2 ?-casein in Wistar rats. Int. J. Food Sci. Nutr. 65, 720–727. https://doi.org/10.3109/09637486.2014.898260
Bruno, J., Nicolas, A., Pesenti, S., Schwarz, J., Simon, J.-L., Léonil, J., Plaisancié, P., 2017. Variants of ?-casofensin, a bioactive milk peptide, differently modulate the intestinal barrier: In vivo and ex vivo studies in rats. J. Dairy Sci. 100, 3360–3372. https://doi.org/10.3168/jds.2016-12067
Dai, R., Fang, Y., Zhao, W., Liu, S., Ding, J., Xu, K., Yang, L., He, C., Ding, F., Meng, H., 2016. Identification of alleles and genotypes of beta-casein with DNA sequencing analysis in Chinese Holstein cow. J. Dairy Res. 83, 312–316. https://doi.org/10.1017/S0022029916000303
De Camargo, G. M. F., 2018. The role of molecular genetics in livestock production. Anim. Prod. Sci. -. https://doi.org/10.1071/AN18013
Farrell, H.M., Jimenez-Flores, R., Bleck, G.T., Brown, E.M., Butler, J.E., Creamer, L.K., Hicks, C.L., Hollar, C.M., Ng-Kwai-Hang, K.F., Swaisgood, H.E., 2004. Nomenclature of the Proteins of Cows’ Milk—Sixth Revision. J. Dairy Sci. 87, 1641–1674. https://doi.org/10.3168/jds.S0022-0302(04)73319-6
Haq, M.R.U., Kapila, R., Sharma, R., Saliganti, V., Kapila, S., 2014. Comparative evaluation of cow ?-casein variants (A1/A2) consumption on Th2-mediated inflammatory response in mouse gut. Eur. J. Nutr. 53, 1039–1049. https://doi.org/10.1007/s00394-013-0606-7
Ho, S., Woodford, K., Kukuljan, S., Pal, S., 2014. Comparative effects of A1 versus A2 beta-casein on gastrointestinal measures: A blinded randomised cross-over pilot study. Eur. J. Clin. Nutr. 68, 994–1000. https://doi.org/10.1038/ejcn.2014.127
Jianqin, S., Leiming, X., Lu, X., Yelland, G.W., Ni, J., Clarke, A.J., 2016. Effects of milk containing only A2 beta casein versus milk containing both A1 and A2 beta casein proteins on gastrointestinal physiology, symptoms of discomfort, and cognitive behavior of people with self-reported intolerance to traditional cows’ milk. Nutr. J. 15, 1–16. https://doi.org/10.1186/s12937-016-0147-z
Jinsmaa, Y., Yoshikawa, M., 1999. Enzymatic release of neocasomorphin and ?-casomorphin from bovine ?-casein. Peptides 20, 957–962. https://doi.org/10.1016/S0196-9781(99)00088-1
Kami?ski, S., Ru??, A., Cie?li?ska, A., 2006. A note on frequency of A1 and A2 variants of bovine beta-casein locus in Polish Holstein bulls. J. Anim. Feed Sci. 195–198. https://doi.org/10.22358/jafs/66892/2006
Massella, E., Piva, S., Giacometti, F., Liuzzo, G., Zambrini, A.V., Serraino, A., 2017. Evaluation of bovine beta casein polymorphism in two dairy farms located in northern Italy. Ital. J. Food Saf. 6, 131–133. https://doi.org/10.4081/ijfs.2017.6904
Mishra, B.P., Mukesh, M., Prakash, B., Sodhi, M., Kapila, R., Kishore, A., Kataria, R.R., Joshi, B.K., Bhasin, V., Rasool, T.J., Bujarbaruahx, K.M., 2009. Status of milk protein, ?-casein variants among Indian milch animals. Indian J. Anim. Sci.
NÚCLEO NORDESTE DE CRIADORES DE SINDI. Disponível em: Acesso em 02 de julho de 2018.
Olenski, K., Kami?ski, S., Szyda, J., Cieslinska, A., 2010. Polymorphism of the beta-casein gene and its associations with breeding value for production traits of Holstein-Friesian bulls. Livest. Sci. 131, 137–140. https://doi.org/10.1016/j.livsci.2010.02.023
Ole?ski, K., Cie?li?ska, A., Suchocki, T., Szyda, J., Kami?ski, S., 2012. Polymorphism in coding and regulatory sequences of beta-casein gene is associated with milk production traits in Holstein-Friesian cattle. Anim. Sci. Pap. Reports 30, 5–12.
Rahimi, Z., Gholami, M., Rahimi, Z., Yari, K., 2015. Evaluation of beta-casein locus for detection of A1 and A2 alleles frequency using allele specific PCR in native cattle of Kermanshah, Iran. Biharean Biol. 9, 85–87.
Rangel, A.H.N., Zaros, L.G., Lima, T.C., Borba, L.H.F., Novaes, L.P., Mota, L.F.M., Silva, M.S., 2017. Polymorphism in the Beta Casein Gene and analysis of milk characteristicsin Gir and Guzerà dairy cattle. Genet. Mol. Res. 16. https://doi.org/10.4238/gmr16029592
Rijnkels, M., 2002. Multispecies comparison of the casein gene loci and evolution of casein gene family. J. Mammary Gland Biol. Neoplasia 7, 327–345. https://doi.org/10.1023/A:1022808918013
Santana Jr, M. L., Pereira, R. J., Bignardi A. B., Ayres D. R., Menezes G. R. O., Silva L. O. C., Leory G., Machado C. H. C., Josahkian L. A., Albuquerque L. G., 2016. Structure and genetic diversity of Brazilian Zebu cattle breeds assessed by pedigree analysis. Livest. Sci. 187, 6-15. http://dx.doi.org/10.1016/j.livsci.2016.02.002


Sindi solidário integra campanha do HA

Por Márcia Benevenuto Causas sociais mobilizam criadores da raça em todo o Brasil. Leilão Direito de Viver, edição Sindi, pe...

Conheça os jurados do PNAT 2020

A 11ª edição do Programa Nacional de Avaliação de Touros Jovens (PNAT) 2020 terá, pela primeira vez, uma comissão julgadora, res...

ABCSindi lamenta morte de Manoelito Dantas Vilar

Mais uma grande perda na pecuária zebuína foi registrada nesta terça-feira (28). Faleceu, aos 83 anos, o pecuarista Manoel Dantas Vi...

Bichuette recebe honraria ExpoGenética 2020

Ronaldo Bichuette, presidente da ABCSindi é um dos homenageados da ExpoGenética 2020. O nome dele foi indicado e eleito na categorias...

Sindi participa da ExpoGenética 2020

O Sindi tem presença garantida na ExpoGenética 2020 com a promoção da raça através de LIVES e debates virtuais, divulgação de a...

Pecuária protege 10 mi de hectares ao ano

Pecuária protege 10 milhões de hectares ao ano Entre 1990 e 2019, aumento da produtividade pecuária evitou que 270 milhões de h...

NOSSOS PARCEIROS